top of page

Você está em: GENÉTICA

    Podemos entender a evolução biológica como o resultado das constantes mudanças nas populações de seres vivos, que podem ser em características físicas, comportamentais ou fisiológicas. Se as características dos seres vivos têm relação direta com o seu material genético, aí existe uma ligação muito profunda entre evolução e genética! As mudanças no genoma (que podem ser, por exemplo, mutações) acontecem a todo tempo de forma aleatória, gerando modificações nos indivíduos e nas populações, que são positiva ou negativamente selecionadas pelo ambiente em que esses indivíduos estão, afinando a relação daquele ser vivo com o ambiente. Essa é a lógica mais pura e simples da evolução biológica.

    Outra fonte de modificação da composição genética de uma população é a reprodução sexuada, onde por via de regra, se combinam metade dos cromossomos de cada um dos genitores e geram um indivíduo único. Se formos pensar em indivíduos humanos, por exemplo: você é o resultado da combinação de um determinado conteúdo genético da sua mãe e do seu pai. Não existe absolutamente ninguém geneticamente idêntico a você.

Como a genética se relaciona com a Evolução?

A nossa primeira impressão é achar que, como os gêmeos univitelinos são oriundos de um mesmo zigoto, eles são perfeitamente idênticos. Sobre isso, já adianto a informação: não necessariamente. Claro que eles possuem o maior grau de semelhança genética que dois seres humanos podem ter, mas olhando no micro, no detalhe, temos detalhes a atentar: 

Sobre o genótipo, “Acredito que o genoma com o qual você nasce não o mesmo com o qual você more – pelo menos não para todas as células no organismo”. Carl Bruder especula isso com base no fato de que o nosso genoma sofre modificações naturais durante a nossa vida, sejam elas causadas por substâncias mutagênicas (tipo radiação, toxinas, etc) ou mutações espontâneas, como explico ali embaixo. Portanto, a ideia é que gêmeos idênticos se distanciem geneticamente durante a vida já que essas mudanças vão se acumulando, além do fato do estudo apontar que os eles podem já nascer com algumas diferenças nos seus alelos. Veja o artigo resumido na Scientific American.

Sobre o fenótipo, a gente entende que a expressão do nosso genoma é uma equação que envolve também estímulos do ambiente (a famosa equação "Fenótipo = Genótipo + Ambiente). Podemos dar como exemplos de estímulos ambientais a incidência solar, pressão, duração do dia/noite, temperatura, estímulos à fala, a cognição, interação social, etc. Ou seja, o que a gente vê como fenótipo (seja aparência física, fisiológica ou comportamental) é, na verdade, uma equalização do genótipo com influências ambientais. Por isso, às vezes, apesar de existir uma pré-disposição genética a determinada condição ou doença a pessoa pode nunca manifestá-la e vice versa. A essas diferentes formas que um mesmo genótipo pode gerar de acordo com a variação ambiental damos o nome de plasticidade fenotípica. Com isso, acentuam-se diversas diferenças na aparência física dos gêmeos idênticos, pois eles recebem, ao longo de suas vidas, estímulos diferentes.

         A diferença de ambiente já começa na placenta da mãe, já que ambos os fetos ocupam posições diferentes. Pode parecer pouco, mas as impressões digitais, que se formam no sexto mês de gestação, são determinadas não só pelo genoma, mas pelo contato dos dedos dos fetos com o ambiente intra-uterino. Como estão em posições ligeiramente diferentes na barriga da mãe, eles travam contato com microambientes distintos. Por isso, nem mesmo gêmeos univitelinos têm impressões digitais iguais, sendo esse ainda um excelente método de identificação pessoal (excetuando-se, claro, as pessoas que portam a "Síndrome de Nagali"). As impressões digitais (ID), aliás, são assunto interessante, objeto de estudo de uma especialidade chamada papiloscopia, que coleta e também investiga IDs em cenas de crimes (Ciência Forense). Conheça mais sobre o assunto no artigo de Chemello, E. (2006)

Mas os gêmeos univitelinos não são idênticos?

GENÓTIPO

s.m composição genética de um indivíduo

FENÓTIPO

s.m manifestação visível ou detectável de um genótipo

Nuvem de gafanhotos e a plasticidade fenotípica

A espécie de inseto conhecida como Gafanhoto-do-deserto (Schistocerca gregaria) foi descrita nos tempos bíblicos como uma das pragas do Egito. No melhor estilo "o médico e o monstro", esse animal, inofensivo sob certas condições, se torna uma praga devastadora de plantações sob condições opostas, principalmente em regiões da África, Ásia e Oceania.

Na América do Sul, a espécie é diferente, mas o comportamento é bem parecido: a Schistocerca cancellata (conhecida como gafanhoto migratório sul-americano) devasta plantações na Argentina, Uruguai e na região Sul do Brasil desde as décadas de 1930 e 1940. Mas o que acontece e porquê estamos falando disso aqui, na seção de genética? O gregarismo, característica dessas espécies, é uma resposta à sua plasticidade fenotípica, ou seja, as características físicas do animal mudando de acordo com mudanças no ambiente, sem que isso signifique uma mudança no material genético. Conforme explicamos ali em cima,  a plasticidade fenotípica é a capacidade de mudanças no fenótipo (expressão de características visualmente perceptíveis) sem que o genótipo seja alterado. A capacidade da sua pele ficar naturalmente em tons mais escuros, mesmo que você seja caucasiano, caso more perto da praia é uma demonstração da sua plasticidade fenotípica, por exemplo.Mas qual condição ambiental estimula uma mudança fenotípica nesses gafanhotos? Na sua fase solitária, o gafanhoto-do-deserto é verde e não possui comportamento migratório. Quando vêm as épocas de maior abundância, algo muito previsível ocorre: sua população começa aumentar exponencialmente. Com isso, mudanças físicas começam a ocorrer de modo que ele adquire um comportamento migratório (modo gregário) para buscar mais alimentos.

O que muda no organismo deles para realizar essa mudança fenotípica? Algumas pesquisas já tinham mostrado que estímulos físicos causam a mudança - empurrando, vendo e cheirando outros gafanhotos nas proximidades, mas mais recentemente um novo estudo aprofundou nossa compreensão sobre esse fenômeno, atribuindo essa mudança à um hormônio: serotonina. Esse hormônio é encontrado em todo o reino animal e age principalmente sobre a comunicação nervosa.  Nesse estudo, perceberam que os gafanhotos operando no "modo gregário" tinham cerca de três vezes mais serotonina no sistema nervoso do que aqueles em "modo solitário". Esse hormônio-neurotransmissor tem, no gafanhoto, um efeito de transformar um animal pacato em um voraz comedor de lavouras. Antigamente acreditava-se que o gafanhoto verde-solitário e o amarelo-gregário eram de espécies diferentes, o que foi definitivamente contrariado em 1921. Em "modo de nuvem", o gafanhoto pode comer o equivalente ao seu peso em um dia. A nuvem pode voar 100 km entre cinco e oito horas, devastando o que encontra pelo caminho.

O que a serotonina faz com o organismo desses animais?

Stephen Rogers, um dos autores do estudo que ligou a serotonina a esse comportamento nos gafanhotos diz que 'muitas vezes, ela atua no contexto de alterar o modo como os animais respondem a estímulos vindos de outros animais. Em várias espécies, ela regula a agressividade. Em humanos, a sensação de bem-estar ou depressão. Nos gafanhotos, foi cooptada para produzir a mudança de comportamento que precede a formação da nuvem'. O que ocorre, portanto, é que os gafanhotos jovens (ninfas) que ocorrem em baixas densidades populacionais (fase solitária) tendem a evitar uma à outra, enquanto as que ocorrem em altas densidades populacionais (fase gregária) são atraídas uma pela outra. Essa mudança de comportamento, regulada pela quantidade de serotonina no sistema nervoso desses animais exemplifica brilhantemente como a plasticidade fenotípica ocorre para lidar com mudanças na disponibilidade de recursos no ambiente.

historia

A história da genética e da descoberta do material genético é relativamente recente uma vez que dependeu diretamente de microscópios e técnicas que permitissem a visualização de moléculas, ou pelo menos a suposição de sua existência. Além disso, dependia também de um contexto histórico-científico que reconhecesse a célula como menor unidade funcional de vida.

O que conhecemos hoje como DNA começou a ser estudado em 1869. Ao analisar uma amostra de pus, o bioquímico alemão Johann Friedrich Miescher (1844-1895) identificou uma nova substância ácida e denominou-a nucleína. É o rapaz da foto ao lado. A substância foi assim denominada porque era proveniente dos núcleos das células de glóbulos brancos presentes em amostras de pus. Os núcleos de leucócitos são particularmente fáceis de manipular por serem muito grandes e bem, pus nem se fala, tem muito por aí. Como vimos na história da teoria celular, na própria Alemanha, anos antes, Schleiden e Schwan já haviam percebido que as células não eram apenas um elemento estrutural dos tecidos, mas continha em seu interior uma atividade própria, possivelmente o princípio da vida. Em 1839, Schwann conseguiu reduzir os organismos para um única célula que continha toda a informação vital daquele ser vivo. Já se entendia que a célula é a origem necessária de todo corpo organizado e ambos tinham a ideia de uma grande importância do núcleo para a formação dessas células. Então, Miescher estava realizando justamente novos estudos para desvendar os componentes do núcleo celular já que o papel das células para a vida já estava muito melhor compreendido. Em 1889, vinte anos depois da descoberta da 'nucleína' por Miescher, Richard Altmann (1852- 1900) confirmou a natureza ácida do material e o denominou de ácido nucléico

Embora o papel dessa molécula ainda tenha demorado mais tempo para ser desvendado, a sua composição bioquímica continuou a ser mais detalhada nos anos seguintes: em 1909, Phoebis Levine (1869-1940) e Walter Jacobs (1883-1967) determinaram a organização das moléculas de fosfato, do açúcar e das bases nitrogenadas (adenina, guanina, citosina e timina) como sendo a unidade fundamental do ácido: o nucleotídeo. Vamos ver essa estrutura de forma detalhada daqui a pouco, mas veja como é recente nosso conhecimento sobre a constituição química da molécula mais importante para a vida. Já estamos no século 20 e ninguém nunca viu um ácido nucleico e nem sabe exatamente sua função nas células. 

O trabalho de Gregor Mendel, no século anterior, havia descrito alguns padrões de hereditariedade que ele sintetizou nas suas duas leis. Mas na época, chamava os genes de fatores, para explicar como são transmitidos dos pais para os filhos. O trabalho de outros cientistas por volta do século 20, incluindo Theodor Boveri, Walter Sutton e Thomas Hunt Morgan, estabeleceram que os fatores hereditários de Mendel eram, provavelmente, transmitidos por cromossomos. Ou seja, eles demonstraram que os 'fatores' descritos por Mendel, são genes que estão localizados ao longo dos cromossomos.

Ao perceber que os cromossomos eram compostos por ácidos nucleicos (DNA) e proteínas, os dois componentes químicos se tornaram candidatos ao papel de material genético. Entre os bioquímicos da época, a principal candidata era as proteínas, já que elas eram bem mais conhecidas, estavam presentes nas mais variadas atividades e possuíam uma alta especificidade nas suas ações. Tinha que ser elas. Mais especificamente as histonas, proteínas que ajudam o DNA a se enrolar. Proteínas eram conhecidas por suas sequências diversas de aminoácidos, que podem ser de 20 tipos distintos, enquanto se pensava que o DNA era um polímero entediante e repetitivo de nucleotídeos, que podiam ser de 4 tipos distintos. O que se estabeleceu como um modelo dessa estrutura ainda não estava acurada e ia se mostrar, na verdade, equivocada. Pouco se sabia acerca dos ácidos nucleicos, cujas propriedades físicas e químicas pareciam muito uniformes para serem responsáveis por resultar em características tão numerosas e variadas.

Como descobrimos que o material genético era o DNA?

Em 1928, o bacteriologista britânico Frederick Griffith (1871-1922), na foto ao lado, na tentativa de encontrar uma vacina para a pneumonia, conduziu com o seu irmão uma série de experimentos usando a bactéria Streptococcus pneumoniae em roedores.

Griffith utilizou duas cepas relacionadas de bactéria, conhecidas como R e S.

  • Cepa R. Quando cultivadas em placa de Petri, a bactéria R forma colônias ou aglomerados de bactérias relacionadas, que têm bordas bem definidas e aparência rugosa (daí a sigla "R", de rough). As bactérias R são avirulentas, significando que não causam doenças quando injetadas em ratos.

  • Cepa S A bactéria S formou colônias arredondadas e suaves (daí a sigla "S", de smooth). A aparência suave se dá por conta de um polissacarídeo ou uma capa a base de açúcar produzida pela bactéria. Essa capa protegeu a bactéria S do sistema imune do rato, fazendo-as virulentas (capazes de causar doenças). Ratos em que foram injetadas bactérias S vivas desenvolveram pneumonia e morreram.

Como parte de seus experimentos, Griffith injetou bactérias S mortas por calor (isso é, bactérias que haviam sido aquecidas a altas temperaturas, causando a morte das células) em alguns ratos. Sem surpresas, a bactéria S morta pelo calor não causou a doença nos ratos. Os experimentos tiveram um resultado inesperado, contudo, quando bactérias R, inofensivas, foram combinadas com bactérias S mortas por calor e injetadas em um rato. Não só o rato contraiu pneumonia e morreu, mas quando Griffith retirou uma amostra de sangue do rato morto, ele encontrou bactérias S vivas! Como isso é possível? Griffith concluiu que as bactérias da cepa R teriam adquirido o que ele chamou de "princípio transformante" da bactéria S morta por calor, permitindo que elas se "transformassem" em bactérias S, tornando-se virulentas. Hoje, Frederick Griffith é conhecido como o primeiro engenheiro genético da medicina.

Em trabalhos posteriores, Oswald Avery, Maclyn McCarty e Colin MacLeod indicariam o DNA como a substância responsável pela transformação, mas o meio científico, no entanto, ainda estaria cético e muitos especialistas ainda consideravam as proteínas como as melhores candidatas para o papel de material genético. Além disso, muitos biólogos não estavam convencidos de que os genes de bactérias teriam composição e função semelhantes aos de organismos mais complexos. Essa mania de superioridade humana ainda persistia de forma muito forte no conhecimento Biológico. Todavia, a principal razão para o ceticismo era a falta de conhecimento acerca do DNA. Se em uns esses experimentos resultaram em ceticismo, em outros despertou curiosidade.

Esse texto contém recortes do artigo de Andrade e Caldeira (2009)

Em 1900, William Bateson, um proeminente biólogo britânico, escreveu de modo profético que a “determinação exata das leis da hereditariedade provavelmente causará mais alterações na percepção do ser humano sobre o mundo e em seu poder sobre a natureza do que qualquer outro avanço no conhecimento natural que possa ser previsto”

As proteínas histonas são as responsáveis pelo enovelamento das fitas de DNA. Portanto, era possível perceber a presença de proteínas e ácidos nucleicos no núcleo das células. A dúvida era 'qual o responsável pela hereditariedade?'

Em 1952, Alfred Hershey e Martha Chase obtiveram evidências mais conclusivas de que o DNA é o material genético dos organismos vivos e de vírus. Isso foi feito através de experimentos com vírus bacteriófagos chamado T2 e bactérias Escherichia coli. Bacteriófagos são vírus que infectam bactérias e, como todos os outros vírus, são estruturas biológicas bem simples, consistindo basicamente em um material genético encapsulado por um envoltório proteico. Isso já era conhecido nessa época. Eles também já sabiam que o fago T2 podia transformar rapidamente uma célula de E. coli em uma máquina de produção de fagos T2, liberando muitas cópias quando a célula era rompida. De alguma forma, o T2 conseguia reprogramar a célula hospedeira para produzir vírus. Mas qual dos componentes virais – proteína ou DNA – era o responsável?

Então, aqui estava a chave para descobrir se no momento de infectar uma célula hospedeira, o vírus liberava a parte proteica ou a parte do ácido nucleico (RNA ou DNA). O que quer que ele inserisse na célula hospedeira, seria o seu material genético, visto que ele era necessário para dar curso ao seu ciclo reprodutivo. Pra isso, os cientistas marcaram radioativamente as moléculas proteicas e de ácidos nucleicos dos vírus e viram que o DNA era o material transportado pelo vírus para dentro da célula hospedeira. Depois, com mais técnicas de genética molecular desenvolvidas, conseguimos inclusive saber que dentre os genes do material genético viral, estão aqueles que descrevem a construção da sua capsula proteica. 

Johann Miescher

Evidências adicionais de que o DNA é o material genético foram obtidas no laboratório do bioquímico austríaco Erwin Chargaff (1905-1992). Como já citamos, era sabido que o DNA é um polímero de nucleotídeos, cada um formado por três componentes: uma base nitrogenada (contendo nitrogênio), um açúcar pentose chamado de desoxirribose e um grupo fosfato. A base nitrogenada pode ser de quatro tipos diferentes: adenina (A), timina (T), guanina (G) ou citosina (C). Chargaff analisou a composição das bases do DNA de diversos organismos distintos. Em 1950, ele relatou que a composição das bases do DNA varia de um organismo para o outro. Por exemplo, ele observou que 32,8% do DNA do ouriço-do-mar corresponde à base A; enquanto apenas 30,3% dos nucleotídeos do DNA humano apresentam a base A, e apenas 24,7% do DNA da bactéria E. coli corresponde à base A. As evidências de Chargaff para a diversidade molecular entre as espécies, que muitos cientistas presumiam ausente no DNA, tornaram o DNA o candidato mais plausível ao papel de material genético. Ou seja, ele descobriu que a composição de nucleotídeos do DNA variava entre as espécies, isto é, os mesmos nucleotídeos não se repetiam na mesma ordem como proposto por outro pesquisador.

Chargaff também chamou a atenção para a regularidade peculiar da proporção das bases dos nucleotídeos. No DNA de cada espécie estudada, o número de adeninas e timinas era aproximadamente o mesmo; e o número de guaninas e citosinas era aproximadamente o mesmo. No DNA do ouriço-do-mar, por exemplo, as análises de Chargaff indicaram a presença da seguinte porcentagem de bases: A 5 32,8%, T 5 32,1%; G 5 17,7% e C 5 17,3%. (As porcentagens não são exatamente as mesmas devido às limitações das técnicas utilizadas por Chargaff.) As duas observações a seguir se tornaram conhecidas como as regras de Chargaff:

(1) a composição de bases do DNA varia entre as espécies;

(2) para cada espécie, a porcentagem de bases A e T é aproximadamente igual, e as porcentagens de bases G e C são aproximadamente iguais. 

 

Esses resultados, chamados de regras de Chargaff, acabaram sendo cruciais para o modelo de Watson e Crick da dupla hélice de DNA, que vamos descrever a seguir!

Como descobrimos a estrutura do DNA?

Como já ressaltei anteriormente, a história da genética molecular é recente. Em 1952, cerca de 70 anos atrás, Hershey e Chase conseguiram evidências bem contundentes sobre o papel dos ácidos nucleicos na hereditariedade e a sua centralidade no controle do metabolismo celular. Com isso, o DNA ganhou muito mais atenção e estudos para desvendar detalhes sobre a sua estrutura química e espacial começaram a bombar. O conjunto de informações que a comunidade científica dispunha até a década de 1950, permitiu-lhes conhecer, ainda que não totalmente, a composição química da molécula de DNA. Mas, de que modo o sal, a base e o açúcar, componentes da unidade básica do DNA (nucleotídeo), se ligavam e formavam uma estrutura espacial, ainda era uma incógnita para os cientistas.

Assim, alguns laboratórios da época se debruçaram sobre o estudo dos ácidos nucleicos. No Cavendish Laboratory, em Cambridge, trabalhavam o biólogo ames Watson e o físico e bioquímico Francis Crick. Em King’s College trabalhavam Maurice Wilkins (1916-2004) e Rosalind E. Franklin (1920-1958). Nos Estados Unidos, havia o grupo do Instituto de Tecnologia da Califórnia, conhecido como Caltech, onde trabalhava Linnus Pauling (1901-1994). Esses são importantes personagens da história da descoberta da estrutura química do DNA.

Em um congresso em Nápoles, em 1951, Wilkins apresentou o seu duplo objetivo de pesquisa sobre ácidos nucléicos: a estrutura e a orientação molecular de ácidos nucléicos estudados em preparados obtidos a partir de espermatozóides de moluscos do gênero Sepia. Essa palestra, ouvida por Watson, foi decisiva para a sua transferência de Copenhague para Cambridge. A partir de então ele inicia suas pesquisas relacionadas à estrutura do DNA. O que se estabeleceu entre essas frentes foi uma corrida pela elucidação desse fato ainda desconhecido. Após assistir uma palestra de Rosalind Franklin e ter acesso à uma imagem que ela obteve através de cristalografia do cristal de DNA e anotar vagamente alguns cálculos que ela havia feito, Watson e Crick apresentaram, em 1951, um primeiro modelo, que era constituído de três cadeias em hélice (uma tripla-hélice). Entretanto, o modelo apresentava problemas químicos de composição e o modelo foi invalidado. Linus Pauling (que descobriu a estrutura secundária da proteína) também propôs um modelo de tripla-hélice com cálculos mais ajustados, o que levou inclusive Watson e Crick a acreditarem que a estrutura havia sido elucidada. Mas, ao detectar uma série de inconsistências na proposta de Pauling, ele retomou com ânimo suas pesquisas. Parece, então, que o modelo de Pauling serviu como elemento de acirramento na corrida pela publicação da estrutura do DNA. 

Desta forma, Watson e Crick perceberam que um modelo de dupla-hélice seria mais consistente do que qualquer outro. Watson organizou o modelo das bases em papel e, com auxilio de Jerry Donohue (1920-1985) – que apresentou configurações de bases desconhecidas por Watson,– identificou quais formas bioquímicas das bases seriam mais apropriadas para a estrutura do DNA. O novo modelo deveria, então, estar em acordo com os dados de Chargaff e, por meio de tentativas e erros, Watson viu que poderia nir adenina com timina e citosina com guanina. Essas proporções, descritas por Chargaff, correspondiam exatamente a esse emparelhamento

Watson e Crick contaram com a ajuda crucial do químico Jerry Donohue para utilizar corretamente os dados de Chargaff. Além disso, as imagens de cristalografia de Rosalind e os cálculos realizados por Wilkins foram determinantes para embasar os autores. 

Watson e Crick, então, confeccionaram um modelo em metal (imagem ao lado) e chamaram Wilkins e Rosalind para avaliá-lo, e estes concordaram com a estrutura proposta. Decidiram então enviar a publicação para a revista Nature, citando os principais dados e autores que ajudaram nessa construção. Além disso, foi decidido, também, que Wilkins e auxiliares, bem como, Rosalind Franklin e Raymond G. Gosling mandariam também artigos independentes, com os dados experimentais de difração que sustentavam o modelo. Os artigos foram publicados no volume 171 da revista Nature, de abril de 1953.

Maurice Wilkins

Rosalind Franklin

James Watson e Francis Crick, respectivamente

À esquerda vocês poderão ter acesso aos artigos originais publicados pelos cientistas que citamos no discorrimento sobre a história da descoberta da estrutura do DNA. À direita, algumas imagens extraídas desses originais.

Rosalind Franklin e seu papel na construção do modelo da dupla hélice do DNA

Esse quadro foi inspirado e possui recortes de dois artigos de Marcos Rodrigues da Silva (1) (2)

Pouco se fala da participação de mulheres na ciência quando o recorte é histórico. Raramente mulheres foram inventoras e cientistas reconhecidas historicamente por suas produções, quando assim conseguiam de fato produzir algo. A histórica segregação das mulheres do campo científico-tecnológico reproduzia o padrão societário da época. Mesmo que pertencessem a aristocracia, nas sociedades europeias que fundaram a ciência moderna, as mulheres  eram reservadas de atividades intelectuais e políticas. Essas atividades eram restritas aos homens brancos da aristocracia. Até hoje vivemos os reflexos culturais dessa estruturação e vemos que países como o japão contém apenas 20% de cientistas mulheres hoje em dia. O Brasil e Portugal são os líderes mundiais em igualdade de gênero na ciência, com 49% de cientistas mulheres, contra 51% de homens. Mas nem sempre foi assim: se voltarmos apenas uma década, eramos apenas 38% do total de cientistas. Você pode consultar esse e outros dados aqui. Imagine no século passado?

A história da construção do modelo da dupla hélice do DNA é uma história marcada por muitos pequenos episódios, por uma construção coletiva e por aspectos que transcendem o científico propriamente dito; a respeito deste último ponto, em geral, é lembrado que a dupla hélice do DNA de James Watson e Francis Crick foi, entre outras coisas, um produto de uma série de circunstâncias institucionais e pessoais – sobretudo no que diz respeito ao relacionamento entre dois laboratórios de pesquisa da Inglaterra, e também no que diz respeito ao relacionamento entre os cientistas que atuavam nestes laboratórios. Maurice Wilkins e Rosalind Franklin não tinham uma relação exatamente amistosa, apesar de trabalhar com o mesmo tema, na mesma universidade. A relação entre a corrida pela descoberta da estrutura do DNA e a história de Rosalind Franklin é repleta de misoginia, como diversos artigos da historiografia em ciência relatam. Watson e Crick tiveram acesso à documentos e relatórios produzidos na King's College, sem o conhecimento dos autores, como relata Watson em seu livro, lançado em 1968, chamado "The Double Helix" (A Dupla Hélice)

“Rosy, é claro, não nos deu diretamente seus dados. Aliás, ninguém na King's percebeu que estava em nossas mãos".

Quando essa admissão apareceu no best-seller e aclamado livro, ele era professor de Harvard e ganhador do Nobel (ele dividira o prêmio de medicina e fisiologia em 1962, com Crick e Maurice Wilkins, do King's College.) A essa altura, Franklin havia morrido - em 1958, aos 37 anos, de câncer de ovário. Rosalind, já num seminário de novembro de 1951 no King’s, se intrigava com a possibilidade de as evidências empíricas apontarem uma estrutura helicoidal para o DNA (as notas deste seminário, especificamente, contêm explicitamente a sugestão de que o DNA poderia ser helicoidal). Entretanto, alegando que Rosalind não tinha uma compreensão da função e importância biológica do DNA, Watson, Crick e Wilkins não demonstraram muito entusiasmo com a participação de Rosalind no episódio da descoberta da estrutura do DNA, apesar do trabalho dela ter fornecido a evidência empírica mais importante para a dupla-hélice.

Inclusive já em 1951, Rosalind apresentara uma comunicação na qual sugeria que os grupos de fosfato do DNA estariam na parte externa da hélice; além disso Rosalind acreditava que a forma B do DNA era uma dupla-hélice (embora tivesse reservas quanto a esta inferência no que dizia respeito à forma A. Portanto é surpreendente que Watson (que assistiu à comunicação acima mencionada) tenha criado o mito de que Rosalind fosse anti-hélica, já que pouquíssimas pessoas àquela época o eram. Rosalind e todos os outros cientistas aqui relatados estavam a par da tendência da época de considerar a representação heicoidal do DNA.

genetica molecular

O que há de tão importante no DNA?

Já dissemos que todos os seres vivos possuem DNA e que basicamente todas as células vivas possuem esse material genético. Todos sabemos que o DNA é o principal agente da hereditariedade e isso ocorre por que ele contém as sequências para sintetizar todas as proteínas que o corpo é capaz de sintetizar. Aí você pensa "nossa, só isso? Essa é a grande importância dele? Proteína também é adquirida pela alimentação". Pare para pensar por um segundo no que são as proteínas dentro do nosso organismo: elas têm função de transporte de oxigênio (hemoglobina, na foto ao lado), transporte de substâncias de dentro para

fora da célula e vice-versa (proteínas transmembrana), catalizam reações (enzimas, que são estruturalmente proteicas), têm função contrátil no músculo (actina e miosina); têm função hormonal (muitos hormônios são proteicos) e controle da glicemia do sangue (insulina e glucagon); têm função no sistema imune, onde anticorpos e outras substâncias de defesa são proteínas, além do fato do agente impermeabilizante da pele ser uma proteína (queratina). O tom de cor da pele e olhos é definido por uma proteína pigmentosa (melanina) e os cabelos e unhas são 85% constituídos de proteína (queratina). Isso tudo além da função estrutural e locomotora, que as proteínas possuem quando compõem os músculos. Levando em consideração que todas as funções vitais são musculares e que todas as reações metabólicas no corpo dependem direta ou indiretamente de enzimas, dá para ter uma pequena noção da imensa importância das proteínas no nosso organismo, não é? Então, agora, parece que codificar a síntese de proteínas não parece uma função banal, visto que a ausência de qualquer uma dessas proteínas citadas pode ser desastrosa para o organismo. Deixo abaixo alguns links para você conhecer algumas doenças provenientes da má ou não-síntese de proteínas. Algumas delas já foram e podem voltar a ser temas de questões do ENEM e UERJ.

Onde e como está o DNA?

Nas células procariotas, típicas de bactérias e arqueobactérias, não há um núcleo. Nesse caso, o DNA fica no citoplasma mesmo. Nas células eucariotas, que possuem núcleo e outros compartimentos, o DNA está no núcleo. Se considerarmos um cachorro (Canis lupus familiaris), estamos falando de uma espécie com 38 cromossomos. Isto significa dizer que todas as células somáticas do seu corpo, dentro de seus núcleos, possuem 38 cromossomos. Então, imaginar 38 longuíssimas moléculas de DNA dentro de um núcleo pode não ser uma tarefa fácil. Agora imagine pensar nas borboletas, que tem 380 cromossomos; ou ainda em uma samambaia, que tem 1.200. Cada espécie tem um número de cromossomos característico, o que aliás é um dos fatores que dificultam que um cruzamento entre duas espécies diferentes resulte em um indivíduo saudável e viável. De fato, as moléculas ficam num estado parcialmente condensado dentro do núcleo, sendo que há algumas regiões mais densamente enoveladas e outras menos. 

Como? O enovelamento das moléculas de DNA se dá por um conjunto de proteínas chamadas Histonas, que enrolam duas vezes o seu perímetro e depois enrolam-se entre si para compactar o material genético, como mostra a imagem.

Por que? O genoma humano (conjunto de todos os cromossomos que temos em uma célula) tem cerca de 6 bilhões de pares de base. Cada par de base tem 3,4×10^-10 m de comprimento (3,4 Angstrom). Multiplicando o tamanho de cada par de base pela quantidade de pares, temos que cada célula tem cerca de 2,04 metros de DNA. Aqui, já fica bem clara a resposta dessa pergunta. O DNA está enovelado dentro do núcleo para caber. Se a célula tem alguns micrômetros, como caberia um genoma que têm, somando-se todos os cromossomos, 2 metros de comprimento? Ah, se você multiplicar o tamanho do seu genoma em uma célula pela quantidade de células que têm no seu corpo (entre 50 e 70 trilhões de células), você tem um comprimento de material genético suficiente para dar mais de 23 mil voltas no Sol ou mais de 2 milhões e 500 mil voltas na Terra.

Implicações: Existem algumas regiões do DNA que estão mais compactadas que outras. Isso pois o DNA contém "informações" que precisam ser "lidas" (vou explicar melhor na parte de Processos Gênicos) e existem regiões que que não possuem genes ou apenas genes não acessados por aquele tipo celular. O que sabemos até então é que estas dificilmente são acessadas para quaisquer leitura (essas regiões são chamadas de Heterocromatina). As regiões com genes que servem ao metabolismo e atividade daquela célula (conhecidas como regiões codificantes) são continuamente acessadas para a síntese de proteínas, sendo sempre alvo dos processos gênicos. Então, são regiões que não podem estar muito compactadas para facilitar o acesso e leitura da informação genética. Essas regiões são chamadas de Eucromatina. Ou seja, o grau de compactação de determinada região têm a ver com a importância daquela informação para a atividade daquela célula. 

O que é o DNA, afinal?

Se trata de uma molécula orgânica, presente em todos os seres vivos. Assim como o RNA, faz parte da classe dos Ácidos Nucleicos, que possuem diversas funções vitais, mas dentre elas uma se destaca: o controle da atividade celular. Os Ácidos Nucleicos são polímeros de nucleotídeos. Isto significa dizer que uma molécula de ácido nucleico é composta por diversos nucleotídeos ligados covalentemente, em sequência, formando uma fita. No caso do RNA, temos uma fita de nucleotídeos simples. No caso do DNA, duas fitas pareiam-se frontalmente por ligações de hidrogênio (na imagem, linha tracejada em azul), formando uma cadeia dupla que se dobra de forma helicoidal. De acordo com Watson e Crick, as duas fitas de DNA enrolam-se uma em volta da outra para formar uma hélice dextrógira. Todas as hélices têm uma direção, que é uma propriedade que descreve como seus filamentos são orientados no espaço. Ser dextrógira significa que ela é virada pra direita. A torção da dupla fita de DNA e a geometria das bases criam um vão maior (chamado de sulco maior) e um vão menor (chamado de sulco menor) que estão ao longo do comprimento da molécula, como mostrado no gif. Esses sulcos são importantes locais de ligação para proteínas que mantêm o DNA e regulam a atividade dos genes.

Os nucleotídeos possuem a seguinte estrutura: Grupamento fosfato (PO4) + Pentose + Base Nitrogenada. As bases nitrogenadas possíveis no DNA são Adenina, Guanina, Citosina ou Timina. No RNA, são Adenina, Guanina, Citosina ou Uracila. Dentro da mesma fita, os nucleotídeos se ligam uns aos outros através da ligação química entre o grupo fosfato de um com o açúcar do próximo, e assim por diante. Essa ligação é chamada de fosfodiéster.

Entre uma fita e outra temos três observações importantes: os nucleotídeos se pareiam frontalmente por afinidade química, e ela é bem específica. No DNA, A Adenina sempre se liga somente à Timina (e vice-versa) por duas ligações de hidrogênio. A Guanina se liga somente à Citosina (e vice-versa) por três ligações de hidrogênio.  Com isso, temos a primeira regra geral de Chargaff, já mencionada anteriormente: o número de timinas é sempre igual ao numero de adeninas e o número de citosinas é sempre igual ao número de guaninas.

Por consequência lógica, o somatório das quantidades de T + A + C + G é igual ao total de nucleotídeos do DNA, já que só existem esses quatro tipos. 

A segunda ideia importante é de que o DNA consiste em uma fita dupla que se acomoda de forma antiparalela, ou seja, duas fitas que correm lado a lado mas apontam para direções opostas. Em uma molécula de DNA de fita dupla, a extremidade 5' (com fostato livre) de uma fita se alinha com a extremidade 3' (com hidroxila livre) de sua parceira, e vice-versa. Isso faz com a que o evento de replicação ocorra de formas diferentes em cada uma das fitas, como vamos ver pra frente.

Por último, temos a ideia de que se as ligações de hidrogênio são interações intermoleculares relativamente fortes, a ligação entre citosina e guanina é quimicamente mais forte em relação à ligação entre adenina e timina, pelo quantitativo de ligações. Isso já foi tema de questão do ENEM e da UERJ, que vocês poderão acessar no final da seção!

A resposta para essa pergunta tem a ver com o que falamos anteriormente sobre eucromatina e heterocromatina, além de fatores de diferenciação celular. Durante nosso desenvolvimento embrionário várias células se diferenciam, gerando diversos tipos celulares muito especializados. 

Se todos os tipos celulares originaram-se de um precursor comum, é lógico pensar que todas essas células humanas possuem exatamente o mesmo conjunto de 46 cromossomos. E está correto. O que diferencia o conjunto de proteínas que um tipo celular produz e o outro não produz é justamente as regiões que estão ilegíveis ou legíveis dentro do DNA desses tipos celulares. Por exemplo, para um neurônio, a região do DNA que está o gene para produção de lactase está muito condensada. Da mesma forma que para uma célula do intestino, a região que contém o gene para produção de neurotransmissores está condensada (heterocromatina). É como se todas as células tivessem o mesmo livro de instruções, mas cada uma lesse capítulos específicos, pertinentes à sua atuação, apenas. Faça a questão ao lado, do ENEM de 2015, que fala sobre o tema!

O DNA está no núcleo de todas as células eucariotas, mas tem algumas que não tem núcleo, como por exemplo as hemácias (glóbulos vermelhos, do sangue) dos mamíferos. As questões evolutivas, bem como o processo de diferenciação e enucleação estão explicados pelo prof. Jubilut no artigo que indico a seguir. Vale complementar apenas que, pelo fato das hemácias não possuírem material genético nem mitocôndrias, não produzem energia e isso que justifica o pouco tempo de vida dessas células (em média, 120 dias).

Quais células, afinal, não possuem DNA?

Se todas as células possuem o mesmo DNA, porque só as intestinais produzem Lactase?

Potencia celular

Não sei se você já ouviu falar de totipotência, pluripotência, multipotência, oligopotência e unipotência. Esses são nomes que dizem respeito à capacidade de uma célula se transformar em diferentes tipos celulares.  A diferença reside no nível de especialização que a célula já alcançou. Isso se baseia no seguinte raciocínio: você já foi uma única célula (zigoto), certo? Aquela única célula deu origem à todas as trilhões que te compõem agora. Como? Simples, a primeira célula tem a capacidade de dar origem à todas as células do organismo, ela é totipotente. Depois, as células vão se tornando cada vez mais diferentes entre si, para especializar suas funções. Nos humanos, a partir do zigoto, as primeiras três divisões (1>2, 2>4 e 4>8) geram células totipotentes, que são essas células capazes de se transformar em qualquer célula humana. Outra forma de dizer isso é: qualquer célula totipotente, qualquer uma dessas oito células, caso seja separada do restante, é capaz de gerar um organismo inteiramente formado. É por isso que o número máximo de gêmeos idênticos em uma gestação natural é 8. Esses testes já foram feitos com sucesso em primatas não-humanos e roedores, onde quando o zigoto se dividiu em duas células, elas foram separadas e cada uma das células se desenvolveu em um organismo completamente formado. Isso só é possível pois as células resultantes das primeiras duas ou três divisões do zigoto ainda mantém a sua totipotência. Pra você não esquecer, “toti” vem de “totus”, que significa “todo”. Totipotente é “todo poderoso”.

Na fase de oito a dezesseis células, as células do embrião se diferenciam em dois grupos: um grupo de células externas que vão originar a placenta e os anexos embrionários (como o cordão umbilical e outras estruturas), e uma massa de células internas que vai originar o embrião propriamente dito. Após 72 horas, este embrião, agora com cerca de cem células, é chamado de blastocisto. É nesta fase que ocorre a implantação do embrião na cavidade uterina, no endométrio. As células internas do blastocisto vão originar as centenas de tecidos que compõem o corpo humano. São chamadas de células-tronco embrionárias pluripotentes. Todos os tecidos (sangue, nervoso, pele, órgãos, etc) são formados de células especializadas. Para alcançar esse grau de especialização, as células vão perdendo a capacidade de se tornar coisas diferentes. Ou seja, com o passar do desenvolvimento embrionário, quase todas as células vão se tornando multipotentes, depois oligopotentes, e depois diferenciadas/unipotentes. Algo importante para assinalarmos aqui é que depois que se especializam (se diferenciam), as células humanas perdem a capacidade de reverter a especialização (desdiferenciar) e/ou se especializarem em células de tecidos diferentes.

Uma ressalva sobre as células pluripotentes é a seguinte: elas podem originar qualquer tipo de célula fetal ou adulta, de fato, mas uma única célula ou um conglomerado de células pluripotentes não pode se transformar em um animal fetal ou adulto por si, porque não tem o potencial de se organizar em um embrião. Isso ocorre pois para se formar o embrião, é necessária a massa de células pluripotentes mas também os anexos embrionários que vão nutrir essa massa de células, como a placenta e o cordão umbilical. Essas estruturas são originadas pelas primeiras divisões zigóticas, com as células ainda totipotentes.

Nesse processo ocorre, na verdade, uma especialização do DNA. As suas células do intestino e do estômago possuem especializações diferentes, correto? Entretanto, por serem oriundas de uma única célula primordial (zigoto), tanto uma quanto outra possuem o mesmo DNA, correto? Sabendo disso, como justificar a inabilidade que as células do intestino possuem de produzir ácido clorídrico, coisa que as células do estômago conseguem fazer? Isso ocorre pois no processo de diferenciação celular, os genes que não são ligados à atuação daquele órgão ou tecido são inativados e passam a se chamar heterocromatina. Então, só faz parte do DNA ativo de uma célula: os housekeeping genes, que são aqueles ligados à manutenção do metabolismo celular, e os genes ligados à atuação específica da célula. As células pancreáticas, por exemplo, têm a capacidade de produzir insulina, glucagon e mais de 20 tipos de enzimas digestivas que compõem o suco pancreático. Todos os genes que expressam essas proteínas estão na região ativa do DNA das células pancreáticas (eucromatina), mas estão na região inativa (heterocromatina) do DNA das células da sua pele ou dos seus neurônios. O DNA é igual, mas as regiões de hetero e eucromatina variam dependendo da especialização da célula. Um organismo adulto mantém algumas células multipotentes, oligopotentes, mas a sua maioria é de células unipotentes mesmo.

Quadrigêmeas univitelinas são muito raras.  O que diferencia os gêmeos univitelinos (idênticos) dos bivitelinos (não-idênticos) é justamente esse processo que venho explicando aqui: os gêmeos bivitelinos são oriundos de uma ovulação onde a mãe, em vez de um, ovula dois ou mais óvulos. Nesse caso, os gêmeos podem ser de sexos diferentes, pois as fecundações são totalmente distintas e eles são geneticamente semelhantes como qualquer par de irmãos não-gêmeos. Agora, os gêmeos univitelinos vêm de uma ovulação comum da mãe, de apenas um óvulo. Ocorre apenas uma fecundação e, depois, nas divisões que se seguem, as células se separam definitivamente, se desenvolvendo em dois, três, quatro ou até oito indivíduos completos. O esquema abaixo resume essa diferença.

Potência Celular: no fundo, uma questão genética

mutacoes

Mutações

Mutações são alterações nas sequências de nucleotídeos que foram originalmente transmitidas a um indivíduo. Isto é, você nasceu com sequências de nucleotídeos herdados da sua mãe e pai e mudanças (mutações) podem ocorrer tanto de forma “induzida” quanto de forma totalmente espontânea. Aqui, é muito importante ressaltar que mesmo as induzidas são imprevisíveis, não havendo até então nenhum mecanismo ou tecnologia capaz de prever o local ou momento de uma mutação, visto que tanto a induzida quanto a espontânea são imprevisíveis.

As mutações “induzidas” são aquelas resultado da exposição do organismo a agentes físicos ou químicos capazes de promover mudanças no DNA, como por exemplo: radiação ionizante (como o “Raio X”), luz ultravioleta (como os “Raios UV” provenientes do sol) e uma ampla variedade de substâncias químicas (poluentes ambientais, agrotóxicos, bombas químicas como o Napalm, substâncias presentes no cigarro, etc). Quando fala que tal coisa "dá câncer", está se dizendo, na verdade, que tal substância ou radiação ionizante promove mutações no DNA que podem ter um efeito na regulação do ciclo celular. Ou seja, se as divisões celulares são eventos que demandam o controle por dezenas de enzimas e marcadores químicos, alterações nessas enzimas podem ter efeito sobre o controle desse ciclo, fazendo com que a célula comece a se multiplicar de forma indefinida e descontrolada. Como você sabe, tecidos são, basicamente, aglomerados de células. Se você tem uma multiplicação irrefreada de células, começa a gerar um tumor, que nada mais é que um tecido tumoral.

Bom, como as mutações são imprevisíveis e aleatórias, podem provocar uma variedade de condições, sendo a mais famosa delas o Câncer. Entretanto, a maioria das mutações são mesmo espontâneas, ocorrendo de forma totalmente natural.

Há um fato desconhecido por muitos, que é: a mutação é, quase sempre, um processo reversível. E muitas das vezes ela é, de fato, revertida. Isso porque o nosso organismo possui um sistema de reparo de DNA muito complexo e elaborado, que analisa constantemente as sequências, corrigindo os erros que surgem espontaneamente por mutação. Além disso, temos que nos desconectar da ideia de que as mutações são coisas horríveis ou amedrontadoras que fazem nascer um terceiro braço nas suas costas. Mutações são majoritariamente, processos naturais. O fato do organismo possuir uma via de correção não deve nos induzir diretamente a dizer que se trata de algo “ruim”, mas simplesmente que, pela premissa de que os processos gênicos são muito bem coordenados, uma modificação na sua estrutura pode gerar mudanças imprevisíveis e modificar a expressão de genes ou até a divisão celular. Agora, atribuir o valor de “bom” ou “ruim” aos resultados fenotípicos das mutações (se houverem) é um papel exclusivo da seleção natural. Se for uma mutação que se expresse numa característica vantajosa, ela vai ser positivamente selecionada pelo ambiente daquele organismo. No caso contrário, será negativamente selecionada. Existem mutações que comprometem genes, gerando muitas doenças bem conhecidas; outras, geram genes novos. Existem ainda mutações que não são percebidas, pois não produzem efeito algum na síntese das proteínas, não gerando assim nenhuma consequência fenotípica (isto é, não sofre seleção natural). A variedade de mutações e efeitos é tão infinita quanto a variedade de sequências de DNA em si e, a seleção natural, a partir desse efeito, que dá o rumo da evolução dos organismos.

Tipos de Mutações

Em relação ao tipo de célula:
1) Se ocorre em células somáticas, a mutação ocorrerá apenas em células descendentes destas células. As células cancerosas, por exemplo, geram outras células cancerosas por esse motivo. Entretanto, as mutações que ocorrem nas células somáticas não são transmitidas para a prole. A mutação morre com o individuo.

2) Se ocorre em células germinativas (reprodutivas), isto é, ovócitos e espermatócitos, seus efeitos podem ser expressos na prole. Podem ocorrer em qualquer estágio do ciclo reprodutivo (da célula germinativa primordial aos gametas).

 

Em relação ao tipo de modificação produzida, já sabemos que o DNA é constituído por nucleotídeos (também chamados de bases). Para essa sequência de nucleotídeos traduzir a produção de uma proteína, eles são lidos de três em três (trincas), como veremos lá na parte de transcrição e tradução. Por isso, modificações podem gerar mudanças na leitura ou não. Vamos ver como cada uma dessas mutações age sobre a sequência de bases a seguir: AGA.TCA.AAT.CGC.CCC

Perceba:

1) Substituição: é quando uma base é substituída por outra. Esse tipo de mutação pode ser percebida ou não, já que nem sempre uma mudança de base por outra provoca mudanças no aminoácido final, como você verá à frente.

Original: AGA.TCA.AAT.CGC.CCC

Mutante: AGA.TCC.AAT.CGC.CCC

2) Deleção: Quando uma base é simplesmente deletada da sequência, alterando a leitura de trincas. Normalmente, todos os aminoácidos que são traduzidos depois do local de mutação serão trocados.

Original: AGA.TCA.AAT.CGC.CCC

Mutante: AGA.TAA.ATC.GCC.CC

3) Adição: quando uma base é adicionada à sequência, alterando a leitura de trincas. Normalmente, todos os aminoácidos que são traduzidos depois do local de mutação serão trocados.

Original: AGA.TCC.AAT.CGC.CCC

Mutante: AGA.TCC.AAA.TCG.CCC.C

Esse é um clássico exemplo real de substituição. Ao substituir a Timina por uma Adenina em determinado gene, o aminoácido resultante muda de Glutamato para Valina, o que transforma completamente a proteína final, que no caso é a hemoglobina (proteína de membrana das hemácias).

processs genicos

Do DNA à Proteína

Então, já que entendemos a importância do DNA ser o principal agente da síntese de proteínas, vamos entender exatamente como isso é feito. São dois processos muito complexos, mas cheios de beleza, chamados: Transcrição e Tradução. No vídeo ao lado temos basicamente um resumo de várias coisas que vimos ao lado, adicionado à dinâmica desses processos que vamos explicar agora.

Antes de iniciarmos nos processos propriamente ditos, cabe entender o que é o RNA. Da mesma classe do DNA, o RNA também é um ácido nucleico; isto é, um polímero de nucleotídeos. O que muda de um para outro são três principais fatores: em relação aos nucleotídeos, (i) a pentose é uma Ribose (no DNA era uma Desoxirribose) e (ii) as bases nitrogenadas possíveis são Adenina, Citosina, Guanina e Uracila, que se liga especificamente à adenina, (o que no DNA é papel da Timina); em relação à estrutura em si (iii) o RNA é uma

fita simples (enquanto o DNA é uma fita dupla). O DNA e RNA trabalham juntos tanto no processo de transcrição quanto de tradução. Existem três tipos de RNA que são utilizados nesses processos: o RNA mensageiro (mRNA), RNA Transportador (tRNA) e RNA Ribossomal (rRNA). O último é o principal componente dos Ribossomos, organelas citoplasmáticas não-membranosas responsáveis pela produção de proteínas.

Transcrição

Vamos supor que a sua irmã recém-nascida esteja com fome, então vai ingerir o leite materno, única fonte de açúcar e nutrientes nos primeiros seis meses de vida. O açúcar do leite, como sabemos, é a lactose (um dissacarídeo) e a enzima digestiva que metaboliza esse açúcar, transformando-o nos monossacarídeos glicose e galactose, é a Lactase:

O bebê não fica produzindo Lactase a todo instante indefinidamente, então ocorre um controle. Essa enzima é produzida pelas células do intestino delgado e assim como diversas outras enzima digestivas, são produzidas quando o indivíduo vai se alimentar. Mamíferos neonatos possuem uma alta atividade de lactase intestinal, em contraste com a maltase (enzima que digere o amido no intestino). Quando o mamífero desmama (e isso inclui a nós, humanos) inverte-se a lógica: a lactase diminui substancialmente a sua atividade enquanto da maltase eleva-se muito. Isso permite fisiologicamente que os jovens mamíferos troquem a lactose pelo amido como principal fonte de carboidrato (Cunningham, 2014). Na maioria das espécies de mamíferos adultos a atividade da lactase é ínfima, o que explica as altíssimas taxas de intolerância à lactose na espécie humana (que aliás é a única espécie de mamífero que pensa ter a necessidade de consumir leite de outra espécie mesmo após o seu desmame).

A lactase, por ser uma enzima (logo, uma proteína) é sintetizada a partir do nosso DNA. Então, no exemplo que demos, apenas quando a sua irmã recém-nascida vai se alimentar, as suas células intestinais começam a produzir lactase para digerir tal leite. Essa enzima é produzida a partir de um gene específico, que está em um trecho do DNA dela, que será acessado nesse momento. Assim, uma molécula de RNA mensageiro (mRNA) será sintetizada a partir do gene que codifica a lactase e sairá do núcleo para ser traduzida no citoplasma. Os processos, de forma mais detalhadas, você encontra no link abaixo, que te direcionada para a página da Khan Academy.

Tabela de códons - cada códon do mRNA vai corresponder a um anti-códon do tRNA, que trará um aminoácido específico. Como você pode ver, como existem 20 tipos de aminoácidos, cada um será traduzido por mais de uma variedade de códon. Exemplo: a Arginina é traduzida pelos códons AGA e AGG. A ocorrência de qualquer uma dessas duas trincas resultará numa arginina.

Tradução

O DNA é um polímero de nucleotídeos, como já dissemos várias vezes. Ele possui regiões codificantes, que são aquelas que possuem as sequências de nucleotídeos que realmente são lidas para gerar as proteínas (os genes). Já dissemos que essas sequências, na transcrição, serão localizadas e servirão de molde para a síntese de uma molécula de RNA mensageiro (mRNA), que será complementar à essa sequência. Vamos supor que o gene seja

                ATATCGTAGCTATCGTATTCGGGATGCG

O mRNA sintetizado a partir dessa sequência será:

             UAUAGCAUCGAUAGCAUAAGCCCUACGC

Esse mRNA então, deixa o núcleo e vai para o citoplasma para sofrer a Tradução, que consiste na leitura de um mRNA por um Ribossomo. Ele "lê" o mRNA de três em três nucleotídeos, o que chamamos de trincas ou códons. Cada trinca corresponde à um  aminoácido. Não, eu não falei errado não. Vai acompanhando a explicação enquanto observa a imagem ao lado. Lá no citoplasma o ribossomo se liga ao mRNA, como se fosse um pão de hambúrguer, que tem a banda de cima (subunidade grande) e a banda de baixo (subunidade pequena). Ele se liga completamente quando fica igual à foto. Na subunidade grande do ribossomo nós vemos três sítios, que é o local onde os RNA transportadores (tRNA) podem se ligar. O tRNA tem duas regiões muito importante para entendermos seu papel nesse processo: em uma extremidade ele carrega o anti-códon, que é uma sequência complementar ao códon que está no mRNA. Isso faz com que cada tRNA seja específico de um códon. Na outra extremidade o tRNA carrega um aminoácido, que se você lembrar das aulas de proteína, vai se ligar que a proteína é uma cadeia de aminoácidos, ligados em sequência por ligações peptídicas.

Pois bem, quando o ribossomo se liga ao mRNA, ele começa a receber os tRNA complementares à sequência, que vão trazendo aminoácidos específicos na outra extremidade. Os aminoácidos vão se ligando em sequência e formando uma proteína.

Resumo do Processo

Vamos pegar a exemplo da imagem ao lado, como seria a proteína resultante passando pelos processos de transcrição e tradução. Depois de abrir a cadeia e expor a sequência do gene:

ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA

Um RNA mensageiro será sintetizado de forma complementar à essa sequência. Esse processo ocorre no núcleo e se chama transcrição:

UACUGCCUAGUCGGCGUUCGCCUUAACCGCUGUAUU

Esse RNA mensageiro sairá do núcleo em direção ao citoplasma. Lá, ele será lido por um ribossomo no formato de códons, que são trincas de nucleotídeos:

UAC.UGC.CUA.GUC.GGC.GUU.CGC.CUU.AAC.CGC.UGU.AUU

Cada trinca corresponderá à um anti-códon de um tRNA diferente. Cada tRNA trará um aminoácido específico, que vão se ligando em cadeia, uns com os outros, na medida que os tRNA vão se ligando e desligando do ribossomo. A sequência de aminoácidos resultante é:

Tirosina-Cisteína-Leucina-Valina-Glicina-Valina-Arginina-Leucina-Asparagina-Arginina-Cisteína-Isoleucina

Nos anos 1800, na Europa, horticultores, criadores de animais e biólogos também tentavam explicar as semelhanças entre os genitores e a descendência. Naquela época, uma visão comum era a teoria da mistura da herança ou a crença de que a herança atuava como uma mistura de líquidos, semelhante ao que ocorre com as tintas: tintas vermelha e branca, quando misturadas, originam cor-de-rosa. Assim, seria esperado que o filho de um genitor alto com um genitor baixo crescesse até uma altura intermediária. Embora a teoria da mistura aparentasse atuar algumas vezes, também estava claro que havia exceções, como crianças altas nascidas de genitores de estatura mediana. A teoria da mistura também não fornecia nenhuma explicação por meio da qual os “líquidos da hereditariedade”, após a mistura, pudessem ser separados — as tintas vermelha e branca não podem ser reconstituídas a partir do cor-de-rosa. Portanto, a expectativa a longo prazo da teoria da mistura ao longo de muitas gerações de intercruzamento entre indivíduos era que todos os membros da população irão expressar o mesmo valor médio de um traço. Claramente, não é assim que a natureza atua. As populações humanas apresentam pessoas com uma diversidade de estaturas, de baixas a altas, e não apresentamos uma estatura média única, apesar das muitas gerações das populações humanas que residiram sobre a Terra. 

Leis de Mendel e Heredogrmamas

Leis de Mendel e leitura de Heredogramas

Mendel foi um monge austríaco que, apesar das dificuldades da família, conseguiu estudar matemática e ciências na Universidade de Viena na metade do século XIX. Era curioso sobre como que as características eram transmitidas entre gerações. Ele escolhe, então, realizar experimentos com uma leguminosa que cultivava: a ervilha (Pisum sativum). Essa escolha não se deu por acaso, mas principalmente pois a planta: (i) é fácil de cultivar e possui muitas sementes; (ii) possuía várias características duais (não-gradativas) e bem contrastantes (amarela ou verde, lisa ou rugosa, flor púrpura ou branca, etc); (iii) as partes masculinas e femininas ficam bem próximas numa mesma flor, favorecendo a autofecundação e a manipulação do Mendel para cruzar algumas plantas; e (iv) as gerações são curtas e o cultivo é rápido [imagina Mendel tivesse escolhido, sei lá, elefantes?].

O primeiro passo foi obter "linhagens puras", mas, como ele fez isso? Basicamente separou plantas que exibiam as características que pretendia estudar e fez sucessivas autopolinizações. Dessa forma, é possível "purificar", isto é, obter plantas homozigotas para essa característica. Se você cruza flores brancas entre si e a cada geração vai excluindo aquelas que nascem púrpuras, você vai aumentando a probabilidade de gerar flores brancas homozigotas. Mendel estudou sete características nas plantas de ervilhas: cor da flor, posição da flor no caule, cor da semente, aspecto externo da semente (liso ou rugosa), forma da vagem, cor da vagem e altura da planta. Pois bem, depois de obter as linhagens puras, Mendel efetuou um cruzamento diferente:  cortou os estames de uma flor proveniente de semente verde e depois depositou, nos estigmas dessa flor, pólen de uma planta proveniente de semente amarela. Efetuou, então, artificialmente, uma polinização cruzada: pólen de uma planta que produzia apenas semente amarela foi depositado no estigma de outra planta que só produzia semente verde, ou seja, cruzou duas plantas puras entre si. Essas duas plantas foram consideradas como a geração parental (P), isto é, a dos genitores. Mendel verificou que todas as sementes originadas desses cruzamentos eram amarelas – a cor verde havia aparentemente “desaparecido” nos descendentes híbridos (resultantes do cruzamento das plantas), que Mendel chamou de F1 (primeira geração "filial", obs: Filius significa "filho" em latim). Concluiu, então, que a cor amarela “dominava” a cor verde. Foi a primeira vez que apareceu na literatura a denominação "dominante" (se referindo ao caráter cor amarela da semente) e "recessivo" (para o verde). Estas denominações substituíam os termos "preponderante" e "latente", utilizadas pelos hibridizadores da época. A seguir, Mendel fez germinar as sementes obtidas em F1 até surgirem as plantas e as flores. Deixou que se autofertilizassem e aí percebe que a cor verde das sementes reaparece na F2 (segunda geração filial).

GENE

Sequência de nucleotídeos capaz de gerar uma proteína

ALELO

Variedades de um gene, que geram diferentes expressões. É comum que hajam duas variedades de alelos (dominante e recessivo), mas pode haver mais de dois, como no sistema de determinação sanguínea (sistema ABO).

LOCUS GÊNICO

Localização de um gene no cromossomo. Em cromossomos homólogos, o mesmo gene ocupa o mesmo locus

HETEROZIGOTO